Abrir o menú principal

Un elemento Alu é un curto tramo de ADN que foi caracterizado orixinalmente pola acción da endonuclease de restrición da bacteria Arthrobacter luteus (Alu), que se pode encontrar no xenoma humano e no doutros primates.[1] Os elementos Alu son os elementos transpoñibles máis abondosos, pois comprenden aproximadamente un millón de copias espalladas polo xenoma humano.[2] Os elementos Alu son tamén coñecidos como xenes egoístas ou parasitos, porque a súa única función é a súa autorreprodución.[3] Derivan dun pequeno ARN 7SL citoplasmático, un compoñente da partícula de recoñecemento do sinal. Os elementos Alu están moi conservados nos xenomas dos primates e orixináronse no xenoma dun antepasado dos Supraprimates.[4]

As insercións Alu foron implicadas en varias doenzas humanas hereditarias e en varias formas de cancro.[5][6]

O estudo dos elementos Alu foi importante para dilucidar a xenética das poboacións humana e a evolución dos primates, incluíndo a evolución humana.[7]

Cariotipo dun linfocito humano feminino (46, XX). Os cromosomas foron hibridados cunha sonda para elementos Alu (verde) e contratinguidos con TOPRO-3 (vermello). Os elementos Alu foron utilizados como un marcador para bandas cromosómicas ricas en xenes.

Índice

A familia AluEditar

A familia Alu é unha familia de elementos repetitivos dos xenomas de primates, incluíndo o xenoma humano.[8] Os elementos Alu modernos teñen unhas 300 pares de bases de lonxitude e, por tanto, son clasificados como elementos nucleares intercalados curtos (SINEs) dentro da clase dos elementos de ADN repetitivos. A estrutura típica é 5' - Parte A - A5TACA6 - Parte B - Cola poliA - 3', onde Parte A e Parte B son secuencias nucleotídicas similares. Dito con outras palabras, crese que os elementos Alu modernos xurdiron dunha fusión cabeza con cola de dous monómeros antigos fósiles (ou FAMs, do inglés fossil antique monomers) distintos hai uns 100 millóns de anos, polo que a súa estrutura é dímera con dous monómeros distintos, aínda que similares (brazos esquerdo e dereito), unidos por un tramo ligador (linker) rico en A.[9] A lonxitude da cola poliA varía entre familias Alu.

Hai aproximadamente un millón de elementos Alu espallados polo xenoma humano e estímase que un 10,7% do xenoma humano consta de secuencias Alu. Porén, menos do 0,5% son polimórficos (é dicir, aparecen en máis dunha forma ou morfo).[10] In 1988, Jerzy Jurka e Temple Smith descubriron que os elementos Alu estaban divididos en dúas grandes subfamilias chamadas AluJ (nomeada coa inicial do nome de Jurka) e AluS (nomeada pola de Smith), e outras subfamilias Alu foron tamén descubertas independentemente por diversos grupos.[11] Posteriormente, unha subfamilia de AluS, incluía elementos Alu activos aos que se denominou AluY. A liñaxe AluJ data de hai 65 millóns de anos é o máis antigo e menos activo no xenoma humano. A liñaxe máis recente AluS é de hai uns 30 millóns de anos e aínda contén algúns elementos activos. Finalmente, os elementos AluY son os máis novos dos tres e teñen a maior disposición a moverse ao longo do xenoma humano.[12] O descubrimento de subfamilias Alu orixinou a hipótese dos xenes mestres/fonte, e proporcionou a ligazón definitiva entre elementos transpoñibles (elementos activos) e ADN repetitivo intercalado (copias mutadas de elementos activos).[13][14]

ARN 7SLEditar

O extremo 5’ dos Alu deriva do ARN 7SL, unha secuencia transcrita por unha ARN polimerase III que codifica o elemento de ARN de SRP, unha abundante ribonucleoproteína.[15]

A secuencia consenso dunha subfamilia principal de Alu contén un elemento de resposta ao ácido retinoico funcional. Os sitios hexámeros do elemento de resposta ao ácido retinoico funcional[16] aparecen a continuación en maiúsculas e solápanse co promotor transcricional interno. Un exemplo dun monómero Alu humano, de 153 pares de bases, derivado do ARN 7SL é: GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCagctACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGT TCTGGGCTGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC.

A secuencia de recoñecemento da endonuclease Alu I é 5' ag/ct 3'; é dicir, o enzima corta o segmento de ADN entre os residuos de guanina e citosina (en maiúsculas arriba).[17]

Elementos AluEditar

Os elementos Alu son responsables da regulación de xenes específicos de tecidos. Están tamén implicados na transcrición de xenes próximos e poden ás veces cambiar o modo en que se expresa un xene.[18]

Os elementos Alu son retrotransposóns e parecen copias de ADN feitas a partir de ARNs transcritos pola ARN polimerase III. Os elementos Alu non codifican produtos proteicos. Son replicados como calquera outra secuencia de ADN, pero depende de retrotransposóns LINE para a xeración de novos elementos.[19]

A replicación e mobilización de elementos Alu empeza por interaccións coas partículas de recoñecemento do sinal (SRPs), que axudan a que as proteínas recentemente traducidas alcanzan os seus destinos finais.[20] O ARN Alu forma un complexo proteico específico cun heterodímero proteico que consta de SRP9 e SRP14.[20] O SRP9/14 facilita a unión dos Alu aos ribosomas que capturan as proteínas L1 nacentes. Así, un elemento Alu pode tomar o control da transcritase inversa da proteína L1, asegurando que as secuencias de ARN dos Alu son copiados no xenoma en vez do ARNm de L1.[12]

Os elementos Alu en primates forman un rexistro fósil que é relativamente doado de descifrar porque os eventos de inserción de elementos Alu teñen unha sinatura características que é fácil de ler e queda gravada fielmente no xenoma de xeración en xeración. O estudo dos elementos AluY (os que evolucionaron máis recentemente) revelou detalles de ascendencia común porque os individuos só comparten unha determinada inserción de elemento Alu se teñen un antepasado común.[Cómpre referencia] Isto débese a que a inserción dun elemento Alu ocorre só de 100 a 200 veces por millón de anos, e non se coñece ningún mecanismo para a súa deleción. Por tanto, os individuos cun elemento probablemente descenden dun antepasado que tiña un, e viceversa para aqueles sen el. En xenética, a presenza ou ausencia dun elemento Alu inserido recentemente pode ser unha boa propiedade a considerar cando se estuda a evolución humana.[7][21][22]

A maioría das insercións de elementos Alu humanos poden encontrarse nas posicións correspondentes nos xenomas doutros primates, pero unhas 7000 insercións de Alu son exclusivas dos humanos.[23]

Impacto dos Alu en humanosEditar

Propúxose que os elementos Alu afectan á expresión xénica e conteñen rexións promotoras funcionais para receptores de hormonas esteroides.[16][24] Debido ao abondoso contido de dinucleótidos CpG atopado nos elementos Alu, estas rexións serven como sitio de metilación, contribuíndo ata co 30% dos sitios de metilación no xenoma humano.[25] Porén, os elementos Alu son tamén unha fonte común de mutacións en humanos, e tales mutacións están a miúdo confinadas a rexións non codificantes dos pre-ARNm (intróns), onde teñen pouco impacto discernible no individuo portador.[26] As mutacións nos intróns (ou rexións non codificantes do ARN) teñen pouco ou ningún efecto sobre o fenotipo dun individuo se a porción codificada do xenoma do individuo non contén mutacións. As insercións Alu que poden ser prexudiciais para o corpo humano están inseridas en rexións codificantes (exóns) ou en ARNm despois do proceso de empalme.[27]

Porén, a variación xerada pode utilizarse en estudos do movemento e ascendencia común das poboaciósn humanas,[5] e o efecto mutaxénico dos Alu[28] e retrotransposóns en xeral xogou un papel significativo na evolución recente do xenoma humano.[29] Hai tamén varios casos nos que as insercións ou delecións Alu están asociadas con efectos específicos nos humanos:

Asociacións con enfermidades humanasEditar

As insercións Alu son ás veces disruptivas e poden causar trastornos herdados. Porén, a maioría das variacións Alu actúan como marcadores que segregan coa enfermidade, polo que a presenza dun determinado alelo Alu non significa que o portador vaia ter necesariamente a doenza. O primeiro informe de recombinación mediada por Alu causante dunha predisposición herdada prevalente ao cancro fíxose nun artigo de 1995 sobre o cancro colorrectal non poliposo hereditario.[30] No xenoma humano, as subfamilias activas máis recentemente foron as subfamilias do Elemento Transposón 6 AluS e 22 AluY debido á súa actividade herdada para causar varios cancros. Así, debido ao seu gran dano herdable é importante comprender as causas que afectan á súa actividade transcricional.[31]

As seguintes enfermidades humanas foron ligadas con insercións Alu:[5][6]

E as seguintes enfermidades foron asociadas con variacións de ADN dun só nucleótido en elementos Alu que afectan a niveis de transcrición:[32]

Outras mutacións humanas asociadas a AluEditar

NotasEditar

  1. Schmid, Carl W; Deininger, Prescott L (1975). "Sequence organization of the human genome". Cell 6 (3): 345–58. PMID 1052772. doi:10.1016/0092-8674(75)90184-1. 
  2. Szmulewicz, Martin N; Novick, Gabriel E; Herrera, Rene J (1998). "Effects of Alu insertions on gene function". Electrophoresis 19 (8–9): 1260–4. PMID 9694261. doi:10.1002/elps.1150190806. 
  3. Kidwell, Margaret G; Lisch, Damon R (2001). "Perspective: Transposable Elements, Parasitic Dna, and Genome Evolution". Evolution 55 (1): 1–24. PMID 11263730. doi:10.1554/0014-3820(2001)055[0001:ptepda]2.0.co;2. 
  4. Kriegs, Jan Ole; Churakov, Gennady; Jurka, Jerzy; Brosius, Jürgen; Schmitz, Jürgen (2007). "Evolutionary history of 7SL RNA-derived SINEs in Supraprimates". Trends in Genetics 23 (4): 158–61. PMID 17307271. doi:10.1016/j.tig.2007.02.002. 
  5. 5,0 5,1 5,2 Batzer, Mark A; Deininger, Prescott L (2002). "Alu Repeats and Human Genomic Diversity". Nature Reviews Genetics 3 (5): 370–9. PMID 11988762. doi:10.1038/nrg798. 
  6. 6,0 6,1 Deininger, Prescott (2011). "Alu elements: Know the SINEs". Genome Biology 12 (12): 236. PMC 3334610. PMID 22204421. doi:10.1186/gb-2011-12-12-236. 
  7. 7,0 7,1 Terreros, Maria C.; Alfonso-Sanchez, Miguel A.; Novick; Luis; Lacau; Lowery; Regueiro; Herrera (September 11, 2009). "Insights on human evolution: an analysis of Alu insertion polymorphisms". Journal of Human Genetics 54 (10): 603–611. PMID 19745832. doi:10.1038/jhg.2009.86. 
  8. Arcot, Santosh S.; Wang, Zhenyuan; Weber, James L.; Deininger, Prescott L.; Batzer, Mark A. (September 1995). "Alu Repeats: A Source for the Genesis of Primate Microsatellites". Genomics 29 (1): 136–144. ISSN 0888-7543. doi:10.1006/geno.1995.1224. 
  9. Häsler, Julien; Strub, Katharina (2006). "Alu elements as regulators of gene expression". Nucleic Acids Research 34 (19): 5491–7. PMC 1636486. PMID 17020921. doi:10.1093/nar/gkl706. 
  10. Roy-Engel, A. M; Carroll, M. L; Vogel, E; Garber, R. K; Nguyen, S. V; Salem, A. H; Batzer, M. A; Deininger, P. L (2001). "Alu insertion polymorphisms for the study of human genomic diversity". Genetics 159 (1): 279–90. PMC 1461783. PMID 11560904. 
  11. Jurka, J; Smith, T (1988). "A fundamental division in the Alu family of repeated sequences". Proceedings of the National Academy of Sciences 85 (13): 4775–8. Bibcode:1988PNAS...85.4775J. PMC 280518. PMID 3387438. doi:10.1073/pnas.85.13.4775. 
  12. 12,0 12,1 Bennett, E. A; Keller, H; Mills, R. E; Schmidt, S; Moran, J. V; Weichenrieder, O; Devine, S. E (2008). "Active Alu retrotransposons in the human genome". Genome Research 18 (12): 1875–83. PMC 2593586. PMID 18836035. doi:10.1101/gr.081737.108. 
  13. Richard Shen, M; Batzer, Mark A; Deininger, Prescott L (1991). "Evolution of the master Alu gene(s)". Journal of Molecular Evolution 33 (4): 311–20. Bibcode:1991JMolE..33..311R. PMID 1774786. doi:10.1007/bf02102862. 
  14. E. Andrew Bennett, Heiko Keller, Ryan E. Mills, Steffen Schmidt, John V. Moran, Oliver Weichenrieder, e Scott E. Devine. Active Alu retrotransposons in the human genome. Genome Research. 2008 Dec; 18(12): 1875–1883. doi: 10.1101/gr.081737.108. PMCID: PMC2593586. PMID 18836035. [1]
  15. Kriegs J et al. (April 2007). Evolutionary history of 7SL RNA-derived SINEs in Supraprimates. Trends Genet 23(4), 158-161.
  16. 16,0 16,1 Vansant, G; Reynolds, W. F (1995). "The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element". Proceedings of the National Academy of Sciences 92 (18): 8229–33. Bibcode:1995PNAS...92.8229V. PMC 41130. PMID 7667273. doi:10.1073/pnas.92.18.8229. 
  17. Ullu E, Tschudi C (1984). "Alu sequences are processed 7SL RNA genes". Nature 312 (5990): 171–2. PMID 6209580. doi:10.1038/312171a0. 
  18. Britten, R. J (1996). "DNA sequence insertion and evolutionary variation in gene regulation". Proceedings of the National Academy of Sciences of the United States of America 93 (18): 9374–7. Bibcode:1996PNAS...93.9374B. PMC 38434. PMID 8790336. doi:10.1073/pnas.93.18.9374. 
  19. Kramerov, D; Vassetzky, N (2005). "Short Retroposons in Eukaryotic Genomes". International Review of Cytology 247: 165–221. PMID 16344113. doi:10.1016/S0074-7696(05)47004-7. 
  20. 20,0 20,1 Weichenrieder, Oliver; Wild, Klemens; Strub, Katharina; Cusack, Stephen (2000). "Structure and assembly of the Alu domain of the mammalian signal recognition particle". Nature 408 (6809): 167–73. Bibcode:2000Natur.408..167W. PMID 11089964. doi:10.1038/35041507. 
  21. Mark Stoneking, Jennifer J. Fontius, Stephanie L. Clifford, Himla Soodyall, Santosh S. Arcot, Nilmani Saha, Trefor Jenkins, Mohammad A. Tahir, Prescott L. Deininger, e Mark A. Batzer. Alu Insertion Polymorphisms and Human Evolution: Evidence for a Larger Population Size in Africa. Genome Research. 1997 Nov; 7(11): 1061–1071. PMCID: PMC310683. PMID 9371742. [2]
  22. W. Scott Watkins, Alan R. Rogers, Christopher T. Ostler, Steve Wooding, Michael J. Bamshad, Anna-Marie E. Brassington, Marion L. Carroll, Son V. Nguyen, Jerilyn A. Walker, B.V. Ravi Prasad, P. Govinda Reddy, Pradipta K. Das, Mark A. Batzer, e Lynn B. Jorde. Genetic Variation Among World Populations: Inferences From 100 Alu Insertion Polymorphisms. Genome Res. 2003 Jul; 13(7): 1607–1618. doi: 10.1101/gr.894603. PMCID: PMC403734. PMID 12805277.
  23. Chimpanzee Sequencing Analysis Consortium (2005). "Initial sequence of the chimpanzee genome and comparison with the human genome". Nature 437 (7055): 69–87. Bibcode:2005Natur.437...69.. PMID 16136131. doi:10.1038/nature04072. 
  24. Norris, J; Fan, D; Aleman, C; Marks, J. R; Futreal, P. A; Wiseman, R. W; Iglehart, J. D; Deininger, P. L; McDonnell, D. P (1995). "Identification of a new subclass of Alu DNA repeats that can function as estrogen receptor-dependent transcriptional enhancers". The Journal of Biological Chemistry 270 (39): 22777–82. PMID 7559405. doi:10.1074/jbc.270.39.22777. 
  25. Schmid, C. W (1998). "Does SINE evolution preclude Alu function?". Nucleic Acids Research 26 (20): 4541–50. PMC 147893. PMID 9753719. doi:10.1093/nar/26.20.4541. 
  26. Lander, Eric S; Linton, Lauren M; Birren, Bruce; Nusbaum, Chad; Zody, Michael C; Baldwin, Jennifer; Devon, Keri; Dewar, Ken; Doyle, Michael; Fitzhugh, William; Funke, Roel; Gage, Diane; Harris, Katrina; Heaford, Andrew; Howland, John; Kann, Lisa; Lehoczky, Jessica; Levine, Rosie; McEwan, Paul; McKernan, Kevin; Meldrim, James; Mesirov, Jill P; Miranda, Cher; Morris, William; Naylor, Jerome; Raymond, Christina; Rosetti, Mark; Santos, Ralph; Sheridan, Andrew; et al. (2001). "Initial sequencing and analysis of the human genome". Nature 409 (6822): 860–921. Bibcode:2001Natur.409..860L. PMID 11237011. doi:10.1038/35057062. 
  27. Deininger, Prescott L; Batzer, Mark A (1999). "Alu Repeats and Human Disease". Molecular Genetics and Metabolism 67 (3): 183–93. PMID 10381326. doi:10.1006/mgme.1999.2864. 
  28. Shen, S; Lin, L; Cai, J. J; Jiang, P; Kenkel, E. J; Stroik, M. R; Sato, S; Davidson, B. L; Xing, Y (2011). "Widespread establishment and regulatory impact of Alu exons in human genes". Proceedings of the National Academy of Sciences 108 (7): 2837–42. Bibcode:2011PNAS..108.2837S. PMC 3041063. PMID 21282640. doi:10.1073/pnas.1012834108. 
  29. Cordaux, Richard; Batzer, Mark A (2009). "The impact of retrotransposons on human genome evolution". Nature Reviews Genetics 10 (10): 691–703. PMC 2884099. PMID 19763152. doi:10.1038/nrg2640. 
  30. Nyström-Lahti, Minna; Kristo, Paula; Nicolaides, Nicholas C; Chang, Sheng-Yung; Aaltonen, Lauri A; Moisio, Anu-Liisa; Järvinen, Heikki J; Mecklin, Jukka-Pekka; Kinzler, Kenneth W; Vogelstein, Bert; de la Chapelle, Albert; Peltomäki, Päivi (1995). "Founding mutations and Alu-mediated recombination in hereditary colon cancer". Nature Medicine 1 (11): 1203–6. PMID 7584997. doi:10.1038/nm1195-1203. 
  31. Jin, Lingling; McQuillan, Ian; Li, Longhai (2017). "Computational identification of harmful mutation regions to the activity of transposable elements". BMC Genomics 18 (Suppl 9): 862. PMC 5773891. PMID 29219079. doi:10.1186/s12864-017-4227-z. 
  32. "SNP in the promoter region of the myeloperoxidase MPO gene". SNPedia. 
  33. Puthucheary, Zudin; Skipworth, James R.A; Rawal, Jai; Loosemore, Mike; Van Someren, Ken; Montgomery, Hugh E (2011). "The ACE Gene and Human Performance". Sports Medicine 41 (6): 433–48. PMID 21615186. doi:10.2165/11588720-000000000-00000. 
  34. Dulai, K. S; von Dornum, M; Mollon, J. D; Hunt, D. M (1999). "The evolution of trichromatic color vision by opsin gene duplication in New World and Old World primates". Genome Research 9 (7): 629–38. PMID 10413401. doi:10.1101/gr.9.7.629 (inactivo 2019-02-17). 

Véxase taménEditar

Ligazóns externasEditar